ID: 1000230649

View in Genome Browser
Species Human (GRCh38)
Location 5:159312205-159312227
Sequence GTGGGGAGACGGACTCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000230641_1000230649 19 Left 1000230641 5:159312163-159312185 CCTTTGGTGCTTAGTTTTCTCAC No data
Right 1000230649 5:159312205-159312227 GTGGGGAGACGGACTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000230649 Original CRISPR GTGGGGAGACGGACTCCTAA GGG Intergenic
No off target data available for this crispr