ID: 1000230837

View in Genome Browser
Species Human (GRCh38)
Location 5:159313796-159313818
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000230833_1000230837 -1 Left 1000230833 5:159313774-159313796 CCGTTAAGTACTTTGGTAACTGC No data
Right 1000230837 5:159313796-159313818 CAGATGAAAGACCCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000230837 Original CRISPR CAGATGAAAGACCCTGTAGG GGG Intergenic
No off target data available for this crispr