ID: 1000232663

View in Genome Browser
Species Human (GRCh38)
Location 5:159330637-159330659
Sequence GTGTGTATCAATAACGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000232659_1000232663 26 Left 1000232659 5:159330588-159330610 CCTTCTGGGGGAATTTCAAGAAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1000232663 5:159330637-159330659 GTGTGTATCAATAACGAGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 67
1000232660_1000232663 1 Left 1000232660 5:159330613-159330635 CCTTTTTTGTTTGTCTCTCTCTG 0: 1
1: 0
2: 21
3: 227
4: 2130
Right 1000232663 5:159330637-159330659 GTGTGTATCAATAACGAGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000232663 Original CRISPR GTGTGTATCAATAACGAGGA GGG Exonic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
907632674 1:56099047-56099069 GTGTGTATTAATAACTTGGTTGG + Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
919178417 1:194049780-194049802 ATGTGTAGAAATAACCAGGAAGG - Intergenic
920929868 1:210377128-210377150 GTGAGTCACAATAACGTGGAAGG - Intronic
1079527780 11:21411433-21411455 GTGTCTATCAATAACAATAATGG + Intronic
1083422224 11:62560475-62560497 GGGTCAATCAATAAGGAGGAAGG + Intronic
1085689601 11:78654572-78654594 GTGTGTCCAAATAACCAGGAGGG - Exonic
1086137714 11:83458865-83458887 GAGTGTATCACTAATGTGGAAGG + Exonic
1091607309 12:1965523-1965545 GTGTGTATGTATCACAAGGAAGG + Intronic
1095907573 12:47393570-47393592 TTGTTTTTCAATAACAAGGATGG - Intergenic
1100368067 12:93940049-93940071 GTGGGTGTGAGTAACGAGGATGG + Intergenic
1105758505 13:23491951-23491973 GTGTGCTTTAATAAGGAGGATGG - Intergenic
1113151054 13:107263896-107263918 GTGTGTATCAATTAGGCAGAGGG - Intronic
1117491192 14:56249616-56249638 GTGTGTCTCATGAACAAGGAAGG + Intronic
1120384675 14:83829133-83829155 GTGTTTTTCAATTACCAGGACGG - Intergenic
1122594586 14:102880768-102880790 CTGTGTATCCATAAAAAGGAAGG + Intronic
1126890444 15:53198875-53198897 GTGTCTATCAATAATAATGATGG + Intergenic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1131387465 15:92019033-92019055 GTGTGCGTCATTAACGAGGCAGG + Intronic
1137547783 16:49416240-49416262 GTGTGTCTCCATAATGAGGGGGG + Intergenic
1138757661 16:59508214-59508236 GTGTGTATCTATAATTATGATGG - Intergenic
1150740195 17:67773205-67773227 ATGGGTATCAGAAACGAGGAGGG + Intergenic
1151341262 17:73472379-73472401 GTCTTTATCAATAAATAGGAGGG + Intronic
1153795387 18:8617266-8617288 GTGTGTATCATTAAAGGGTAAGG - Intronic
1155124467 18:22858223-22858245 GTGTGTATGAATGACTTGGAAGG - Intronic
1158740219 18:60133476-60133498 GTATGTATCAATAAAAAAGATGG - Intergenic
1163844888 19:19632990-19633012 GTTTGTATCACTAAGTAGGATGG - Intronic
1165581759 19:36871398-36871420 GTGTGTATTAATAAAGATAAAGG - Intronic
935279720 2:101506734-101506756 GTTTTTATCATAAACGAGGAGGG + Intergenic
937115559 2:119402673-119402695 ATGTGAATCAATTACCAGGAGGG - Intergenic
937631329 2:124105063-124105085 GTGTGTATTAAAAAGGAGGGAGG - Intronic
1170687370 20:18581634-18581656 GTGTGTATCAAAAAGGAAAATGG + Intronic
1175133226 20:56805021-56805043 GTGTGCATCAATAACCATAAGGG - Intergenic
960678030 3:120216071-120216093 TTTTGTCTCAATAAAGAGGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
969625296 4:8301088-8301110 GTGTGAATCAATAATAAAGATGG - Intronic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
986751422 5:10791350-10791372 TAGTTTATCAATAACTAGGAAGG - Intergenic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
994906335 5:105844502-105844524 GTGAGTATAAATAAGAAGGAGGG + Intergenic
1000232663 5:159330637-159330659 GTGTGTATCAATAACGAGGAGGG + Exonic
1000841359 5:166222667-166222689 GTGTGTATTAAAAACGGAGAAGG - Intergenic
1002865316 6:1116466-1116488 GTCTGTACCAACAAGGAGGAAGG + Intergenic
1004336038 6:14765214-14765236 GTGTGAAGCAATGACGTGGAGGG + Intergenic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1014694859 6:124607645-124607667 GTGTGTGTGTATAACGAAGATGG - Intronic
1017948733 6:159117862-159117884 ATGATTAGCAATAACGAGGAGGG + Intergenic
1020822249 7:12984728-12984750 ATGTGTAGCAATAAATAGGAAGG + Intergenic
1026140483 7:67701600-67701622 GAATGGATCAATAACAAGGAAGG + Intergenic
1030982993 7:116208855-116208877 GTGTGTATCATTGGCAAGGATGG - Intergenic
1034856701 7:154556199-154556221 TTGTGTATCAATTATGAGGTAGG + Intronic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1036768003 8:11561046-11561068 GTGTGGAGCGAGAACGAGGAGGG + Intronic
1037141924 8:15530659-15530681 GTGTTTATCATTCACCAGGACGG + Intronic
1038362903 8:26900800-26900822 GGGTGTATCCATCACTAGGAGGG - Intergenic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1046696664 8:117348222-117348244 GAATGTATCAATAATGAGTAAGG + Intergenic
1055857342 9:80705944-80705966 GTGAGTAGCAATAAGGAGCATGG - Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1192724713 X:73736934-73736956 GTTGGTATCAATCACGAGAATGG - Intergenic
1194818111 X:98470259-98470281 GTGTAAATCCATAACAAGGATGG - Intergenic
1197155938 X:123270272-123270294 GTGTGTATCATCCACTAGGAGGG + Intronic
1198162576 X:134022194-134022216 GAGTGTTTCAAGAATGAGGAAGG - Intergenic
1200924992 Y:8646442-8646464 GTATGCATCAATAATCAGGAAGG - Intergenic
1201271268 Y:12257542-12257564 GTCTCTACCATTAACGAGGATGG - Intergenic