ID: 1000233460

View in Genome Browser
Species Human (GRCh38)
Location 5:159336264-159336286
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000233460_1000233468 -5 Left 1000233460 5:159336264-159336286 CCTTTCCACCTCCCCTTCCTGTG No data
Right 1000233468 5:159336282-159336304 CTGTGGAGAGCCACTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000233460 Original CRISPR CACAGGAAGGGGAGGTGGAA AGG (reversed) Intergenic
No off target data available for this crispr