ID: 1000236474

View in Genome Browser
Species Human (GRCh38)
Location 5:159366360-159366382
Sequence ACACTTTTCCATACAACGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000236474_1000236477 14 Left 1000236474 5:159366360-159366382 CCAGACGTTGTATGGAAAAGTGT No data
Right 1000236477 5:159366397-159366419 TCTTGTTCTGTTCTAATTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000236474 Original CRISPR ACACTTTTCCATACAACGTC TGG (reversed) Intergenic
No off target data available for this crispr