ID: 1000236832

View in Genome Browser
Species Human (GRCh38)
Location 5:159369822-159369844
Sequence CTGTGGACAACTAAAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000236824_1000236832 18 Left 1000236824 5:159369781-159369803 CCCCCAATGTACAGCTTTTATGC No data
Right 1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG No data
1000236829_1000236832 -4 Left 1000236829 5:159369803-159369825 CCATAGTTGGTCCAACGTTCTGT No data
Right 1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG No data
1000236825_1000236832 17 Left 1000236825 5:159369782-159369804 CCCCAATGTACAGCTTTTATGCC No data
Right 1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG No data
1000236827_1000236832 15 Left 1000236827 5:159369784-159369806 CCAATGTACAGCTTTTATGCCAT No data
Right 1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG No data
1000236826_1000236832 16 Left 1000236826 5:159369783-159369805 CCCAATGTACAGCTTTTATGCCA No data
Right 1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG No data
1000236823_1000236832 19 Left 1000236823 5:159369780-159369802 CCCCCCAATGTACAGCTTTTATG No data
Right 1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000236832 Original CRISPR CTGTGGACAACTAAAGAGCA AGG Intergenic
No off target data available for this crispr