ID: 1000240040

View in Genome Browser
Species Human (GRCh38)
Location 5:159400817-159400839
Sequence CTATTAAAGGGAATTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000240040_1000240050 26 Left 1000240040 5:159400817-159400839 CCAGCCTCAATTCCCTTTAATAG No data
Right 1000240050 5:159400866-159400888 AATTATTGGGCTAAACACTATGG No data
1000240040_1000240045 -6 Left 1000240040 5:159400817-159400839 CCAGCCTCAATTCCCTTTAATAG No data
Right 1000240045 5:159400834-159400856 TAATAGTGGCATCAATATGATGG No data
1000240040_1000240047 13 Left 1000240040 5:159400817-159400839 CCAGCCTCAATTCCCTTTAATAG No data
Right 1000240047 5:159400853-159400875 ATGGCCAGAACCTAATTATTGGG No data
1000240040_1000240046 12 Left 1000240040 5:159400817-159400839 CCAGCCTCAATTCCCTTTAATAG No data
Right 1000240046 5:159400852-159400874 GATGGCCAGAACCTAATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000240040 Original CRISPR CTATTAAAGGGAATTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr