ID: 1000243940

View in Genome Browser
Species Human (GRCh38)
Location 5:159433510-159433532
Sequence ATTTGCTTGTCTAGAGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000243940_1000243945 8 Left 1000243940 5:159433510-159433532 CCAGATACTCTAGACAAGCAAAT No data
Right 1000243945 5:159433541-159433563 TCGTGTGCTCAAACCAGGGCAGG No data
1000243940_1000243947 22 Left 1000243940 5:159433510-159433532 CCAGATACTCTAGACAAGCAAAT No data
Right 1000243947 5:159433555-159433577 CAGGGCAGGAGTGTGACCTTAGG No data
1000243940_1000243949 30 Left 1000243940 5:159433510-159433532 CCAGATACTCTAGACAAGCAAAT No data
Right 1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG No data
1000243940_1000243943 3 Left 1000243940 5:159433510-159433532 CCAGATACTCTAGACAAGCAAAT No data
Right 1000243943 5:159433536-159433558 AGGGATCGTGTGCTCAAACCAGG No data
1000243940_1000243944 4 Left 1000243940 5:159433510-159433532 CCAGATACTCTAGACAAGCAAAT No data
Right 1000243944 5:159433537-159433559 GGGATCGTGTGCTCAAACCAGGG No data
1000243940_1000243948 23 Left 1000243940 5:159433510-159433532 CCAGATACTCTAGACAAGCAAAT No data
Right 1000243948 5:159433556-159433578 AGGGCAGGAGTGTGACCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000243940 Original CRISPR ATTTGCTTGTCTAGAGTATC TGG (reversed) Intergenic
No off target data available for this crispr