ID: 1000243949

View in Genome Browser
Species Human (GRCh38)
Location 5:159433563-159433585
Sequence GAGTGTGACCTTAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000243940_1000243949 30 Left 1000243940 5:159433510-159433532 CCAGATACTCTAGACAAGCAAAT No data
Right 1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000243949 Original CRISPR GAGTGTGACCTTAGGGAAGA AGG Intergenic
No off target data available for this crispr