ID: 1000244537

View in Genome Browser
Species Human (GRCh38)
Location 5:159438407-159438429
Sequence CCATAGGTCAGATAGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000244529_1000244537 12 Left 1000244529 5:159438372-159438394 CCAGGGATGGGGCGGGAAGTGAT No data
Right 1000244537 5:159438407-159438429 CCATAGGTCAGATAGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000244537 Original CRISPR CCATAGGTCAGATAGGAACT GGG Intergenic
No off target data available for this crispr