ID: 1000246009

View in Genome Browser
Species Human (GRCh38)
Location 5:159449071-159449093
Sequence CCATTACCACCCAAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000246009_1000246013 3 Left 1000246009 5:159449071-159449093 CCTCTCTCCTTGGGTGGTAATGG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1000246013 5:159449097-159449119 TTTTCCTCTTTGCCTTCACATGG 0: 1
1: 1
2: 5
3: 56
4: 547
1000246009_1000246014 4 Left 1000246009 5:159449071-159449093 CCTCTCTCCTTGGGTGGTAATGG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1000246014 5:159449098-159449120 TTTCCTCTTTGCCTTCACATGGG 0: 1
1: 0
2: 3
3: 41
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000246009 Original CRISPR CCATTACCACCCAAGGAGAG AGG (reversed) Intergenic
900113209 1:1018317-1018339 CCATGACCACCCAAGGGCTGAGG - Intergenic
900773675 1:4565527-4565549 CATTTACAAGCCAAGGAGAGAGG - Intergenic
903289273 1:22297553-22297575 CCATCCCCACCCCGGGAGAGAGG + Intergenic
903527876 1:24006190-24006212 CCATTACCACCTTGGGACAGAGG - Intergenic
907612219 1:55882916-55882938 TATTTACCAGCCAAGGAGAGAGG + Intergenic
907993147 1:59602301-59602323 TCATGACAACCCAATGAGAGAGG - Intronic
911232378 1:95374602-95374624 ACATTCCCACCCAAGGAGACAGG + Intergenic
911786973 1:101963197-101963219 CCATTGCCACCCATGGTGTGTGG + Intronic
911973387 1:104463947-104463969 TCATTAACCCACAAGGAGAGAGG - Intergenic
912068025 1:105771025-105771047 CATTTACAAACCAAGGAGAGAGG + Intergenic
912949598 1:114111657-114111679 CCTTTACCACCCAAGGGCAATGG - Intronic
913180020 1:116312085-116312107 CCATTACACCCCAGTGAGAGGGG + Intergenic
913550302 1:119910869-119910891 GCTTCACGACCCAAGGAGAGGGG - Intergenic
918059070 1:181046184-181046206 CCATGACCACCCAAGGGCTGAGG + Intronic
920334795 1:205237800-205237822 ACAGTGCCACCCAAGGAGATGGG + Intronic
922161757 1:223083331-223083353 CGACTACCAGCCAAGCAGAGGGG - Intergenic
922554065 1:226519728-226519750 CCATGTTCACCCAAGGAGAAGGG + Intergenic
924117585 1:240762843-240762865 CCATCACCACCCAAGGGCTGAGG + Intergenic
1062977008 10:1691245-1691267 CCTCTACAAGCCAAGGAGAGAGG + Intronic
1072523642 10:96252743-96252765 CCATTGTCACGCAAGGAGAGGGG - Intronic
1072535066 10:96356106-96356128 CCACTTCCACCCAGGGAAAGAGG - Intronic
1073945841 10:108749257-108749279 CATTTATCACCCAAGCAGAGAGG - Intergenic
1074918260 10:117979959-117979981 CCATTACCTACCCAGGAGAATGG - Intergenic
1076048738 10:127315474-127315496 CCTCTACCAGCCAAGGAGAGAGG + Intronic
1076090949 10:127684943-127684965 CCCCTACAAGCCAAGGAGAGAGG - Intergenic
1077118795 11:897458-897480 CCATTACCCTCTGAGGAGAGGGG - Intronic
1077815662 11:5683258-5683280 CCATCACCACCCAAGGGCTGAGG + Intronic
1077996451 11:7456526-7456548 CCATTACCACTTATGGAGGGTGG - Intronic
1079734660 11:23981210-23981232 GCATAACCACCCAAAGAGACAGG + Intergenic
1081623136 11:44630916-44630938 CCATTTCCTCCTAAGCAGAGTGG - Intergenic
1083295020 11:61710546-61710568 CCACAACCACCCAGGGAGAGGGG - Intronic
1083654697 11:64223940-64223962 TCATCACCAGCCAAGGAAAGGGG + Exonic
1083998279 11:66282880-66282902 CCACTCCCTCCCAAGTAGAGTGG - Intronic
1084686690 11:70700320-70700342 CCATGACCACCCAGGGAGTGGGG + Intronic
1086498164 11:87425269-87425291 CCATTTACAGCCAAGGAGAGAGG + Intergenic
1088595565 11:111437958-111437980 CCATAGCCCCCCAAGCAGAGGGG + Intronic
1089788446 11:120924825-120924847 CCTTTATCACCCAGGAAGAGTGG + Intronic
1090733193 11:129589410-129589432 CCATTCCCTCCCAGGGAGGGAGG + Intergenic
1091576387 12:1740379-1740401 CAATTGCAAGCCAAGGAGAGGGG - Intronic
1093554854 12:20459897-20459919 CTATTACCACCCAAGGCTGGAGG + Intronic
1095300469 12:40578632-40578654 CTATTACCATCCAAAGAGAAGGG - Intergenic
1096591553 12:52663298-52663320 CCATTACCAAGCCAAGAGAGAGG + Intergenic
1096764063 12:53868686-53868708 CCACTCCCACCCAAGGAATGAGG - Intergenic
1097502304 12:60419835-60419857 CCTCTGCAACCCAAGGAGAGAGG - Intergenic
1097685238 12:62684877-62684899 TCACTACCACCCAGGGAAAGGGG + Intronic
1099217299 12:79868552-79868574 CATCTACCAACCAAGGAGAGAGG - Intronic
1100388419 12:94125043-94125065 TCATAACCACCCAAGGATGGAGG + Intergenic
1101323244 12:103692171-103692193 CATCTACAACCCAAGGAGAGAGG - Intronic
1105433252 13:20356720-20356742 CCATTAATACCCAAGAAGGGGGG + Intergenic
1106106309 13:26736541-26736563 CCATTTCCAACCCAGGAGAGAGG + Intergenic
1106454565 13:29915927-29915949 CATCTACCAGCCAAGGAGAGAGG + Intergenic
1107350057 13:39504541-39504563 GCAATGCCAGCCAAGGAGAGAGG - Intronic
1107598470 13:41988305-41988327 CCATAACCACAGAAGGAGAATGG + Intergenic
1108216510 13:48190241-48190263 CATTTACCAGCCAAGGAGACGGG + Intergenic
1108562107 13:51654304-51654326 CCTTTACTAGCCAAGGAAAGGGG - Intronic
1108745470 13:53388912-53388934 CCATTACAACCAAAGGAAATAGG - Intergenic
1110729266 13:78860805-78860827 CCATTCCTAGCCAAGGAAAGGGG - Intergenic
1113284031 13:108826913-108826935 CCACTACCACCATACGAGAGTGG - Intronic
1114975813 14:28097847-28097869 CAATTACAAGCCAAAGAGAGAGG + Intergenic
1115306539 14:31939332-31939354 CTTTTACAAGCCAAGGAGAGAGG + Intergenic
1116219087 14:42058799-42058821 CCATTTGCTCCCAAGGAGACTGG - Intergenic
1117274630 14:54180228-54180250 CCATTTCCACCCACGGGGATGGG + Intergenic
1118339873 14:64885622-64885644 CCTCTACAAGCCAAGGAGAGAGG - Intergenic
1122118162 14:99537805-99537827 CCATGCCCACCCAAGCAAAGCGG + Intronic
1122370208 14:101225409-101225431 CCAGTACCACCTTAAGAGAGGGG - Intergenic
1124028556 15:25989275-25989297 CTTCTACCAGCCAAGGAGAGCGG - Intergenic
1124147077 15:27137813-27137835 CCACCACCACCAAAGGAAAGGGG - Intronic
1124721301 15:32113199-32113221 CATCTACCAGCCAAGGAGAGAGG - Intronic
1126073350 15:44885337-44885359 CTAGAACTACCCAAGGAGAGAGG + Intergenic
1126739074 15:51759865-51759887 CCCTTACCACCCAAGGCCTGAGG + Intronic
1127295136 15:57602361-57602383 CCATCAACAGCCAAGGAGAAGGG - Intronic
1128656828 15:69468870-69468892 CCATTCCCAGCCAAGGGGAACGG - Intergenic
1128893459 15:71351711-71351733 CCATCACCAGCCCAGCAGAGAGG - Intronic
1130111914 15:80972454-80972476 CCATGACCATCCAGGGAGGGTGG + Intronic
1130392705 15:83473208-83473230 CCACTACCACCAAAGGTGGGTGG + Intronic
1130394669 15:83491825-83491847 ACATAACCAACCAATGAGAGGGG + Intronic
1131355600 15:91743121-91743143 CCATTTCCAGCCAGGGGGAGTGG - Intergenic
1132944323 16:2524189-2524211 CCAATTCCACCCAGGGTGAGTGG - Intronic
1136576487 16:31128202-31128224 TCATCACCACCAAAGGGGAGGGG + Intronic
1137011736 16:35328298-35328320 CACTTACAACCCCAGGAGAGAGG + Intergenic
1137016102 16:35377084-35377106 CACTTACAACCCCAGGAGAGAGG + Intergenic
1137792238 16:51184952-51184974 CCATTGCCACCCAGAAAGAGAGG - Intergenic
1138567799 16:57846202-57846224 CCAGCCCCACCCAGGGAGAGGGG - Intronic
1144771717 17:17763152-17763174 CCATTCCCACCCCAGGAAAGCGG - Intronic
1146446105 17:32934167-32934189 CCAATACCAACCACTGAGAGTGG - Intronic
1147304408 17:39553375-39553397 CCATCAGCACCCAAGGAGAAAGG + Intronic
1149074047 17:52576523-52576545 CCATTACCATCCAAGGAATCCGG + Intergenic
1154160238 18:11975953-11975975 CCATTGCAAGCCAAGGAGAAAGG - Intergenic
1156558272 18:38092079-38092101 CAATTAGCACCCAAGGAGATGGG + Intergenic
1157420939 18:47547011-47547033 TCATTGCCTCCCAAGGAGAATGG + Intergenic
1158282438 18:55842098-55842120 CCTCTACAAGCCAAGGAGAGAGG - Intergenic
1158326700 18:56320727-56320749 CCTCTACAAGCCAAGGAGAGAGG - Intergenic
1159305834 18:66640915-66640937 CCTCTGCCAACCAAGGAGAGAGG - Intergenic
1159676238 18:71287333-71287355 CATCTACCAGCCAAGGAGAGAGG - Intergenic
1160001474 18:75028306-75028328 CATCCACCACCCAAGGAGAGAGG - Intronic
1160329180 18:77976942-77976964 CCCTTCCCACCCTATGAGAGTGG + Intergenic
1161887436 19:7007680-7007702 CCAAATCCACCCAAGGGGAGGGG + Intergenic
1161887773 19:7010224-7010246 CCAAATCCACCCAAGGGGAGGGG - Intergenic
1163181664 19:15608651-15608673 CCATGACCACCCAAGGGCTGAGG - Intergenic
1168682857 19:58328592-58328614 GCTTTACCAACCAAGGAGGGTGG - Intronic
925434653 2:3826658-3826680 CCATTCCTACCCACAGAGAGGGG - Intronic
925710875 2:6739126-6739148 CACCTACCAGCCAAGGAGAGAGG + Intergenic
926656035 2:15407357-15407379 CCAGGACCTGCCAAGGAGAGGGG + Intronic
928274487 2:29887542-29887564 CCATCACCTCTCAATGAGAGAGG + Intronic
928387542 2:30883252-30883274 CCCTTATCTCCCAGGGAGAGGGG - Intergenic
929179069 2:39013774-39013796 CCTTTCCCAAACAAGGAGAGGGG - Intronic
929903503 2:46026147-46026169 CCATTTCCTACCAAGGAGAAAGG - Intronic
930775089 2:55163099-55163121 CCATTACCTCCCATGGAGACAGG - Intergenic
932151530 2:69377310-69377332 CCATTATAAACCAAGGAGATTGG - Intronic
933688862 2:85163757-85163779 CCCCTACAAGCCAAGGAGAGAGG - Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
936340099 2:111623506-111623528 CCATTACTGCTGAAGGAGAGTGG - Intergenic
936632447 2:114218186-114218208 CAAATGCCACCCAAGGACAGAGG - Intergenic
938105115 2:128524774-128524796 CCTCTACAAGCCAAGGAGAGAGG + Intergenic
945627239 2:212225872-212225894 CCATACCCACTCAAGGGGAGGGG - Intronic
948494722 2:238340020-238340042 ACACTGCCACCCAAGGACAGCGG - Intronic
1170170275 20:13403278-13403300 CCATTTCCACCAAAGGAGCACGG + Intronic
1172623289 20:36333495-36333517 CCATGACCACCCAGGGAGTCAGG - Intronic
1172961430 20:38803041-38803063 TAATTACAAACCAAGGAGAGAGG - Intergenic
1173254508 20:41384621-41384643 CATTTACAAGCCAAGGAGAGGGG - Intergenic
1173597235 20:44266641-44266663 CACTTACAAGCCAAGGAGAGAGG - Intronic
1175750487 20:61493728-61493750 GCATTACCATCCAAGAAGACTGG - Intronic
1176898667 21:14414555-14414577 CCATCTCCAACCAAGGAGAAAGG + Intergenic
1176900274 21:14432901-14432923 CCATCTCAAGCCAAGGAGAGAGG + Intergenic
1177775076 21:25558970-25558992 CATCTACCAGCCAAGGAGAGGGG - Intergenic
1178892343 21:36530666-36530688 CGATTCCCACCAAAGGAGAGGGG + Intronic
1182451829 22:30426317-30426339 CAACCACCACCCAATGAGAGAGG - Intronic
1182684516 22:32111268-32111290 CCATCTGCAACCAAGGAGAGAGG - Exonic
1183926467 22:41209900-41209922 CCACTGCCATCCAAGGAGCGAGG - Exonic
1184295179 22:43518866-43518888 CCAGCTCCACTCAAGGAGAGAGG + Intergenic
950207941 3:11094354-11094376 CCATCACCACCCAAGGGCTGAGG + Intergenic
950872013 3:16237742-16237764 CCAGGGCCTCCCAAGGAGAGTGG - Intergenic
957952847 3:87147417-87147439 CCATTTTCACACAATGAGAGCGG + Intergenic
961563741 3:127748645-127748667 CACTTACAAGCCAAGGAGAGAGG + Intronic
963761871 3:149292943-149292965 CCATTTGTGCCCAAGGAGAGAGG - Intergenic
964974235 3:162600056-162600078 CCATGACCACCCAAGGGCTGAGG + Intergenic
965288104 3:166843167-166843189 CCATAACCACCCAAGGGCTGAGG + Intergenic
966620416 3:181956857-181956879 CCAATACCACCCAAGTAGGCAGG - Intergenic
966639503 3:182174059-182174081 CCATGACCAACCAATGACAGTGG - Intergenic
967584682 3:191197500-191197522 CCATTACCTTCAAAAGAGAGAGG - Intergenic
969362416 4:6673079-6673101 CCATCACCACCCAAGGGCTGAGG + Intergenic
970407078 4:15774168-15774190 CACTTACAAGCCAAGGAGAGAGG + Intergenic
970988018 4:22180610-22180632 CCCCTACAAGCCAAGGAGAGAGG + Intergenic
972256788 4:37364393-37364415 CCATTACCACCAATGGAGGCAGG + Intronic
972990314 4:44815467-44815489 CCATTCCCAGCCAAGGGAAGTGG - Intergenic
974225675 4:59039654-59039676 CCACTTCCAACTAAGGAGAGAGG + Intergenic
975331837 4:73124926-73124948 CCAGAACAAGCCAAGGAGAGTGG + Exonic
976170922 4:82303448-82303470 CCTTTCCCAGCCAAGGAAAGGGG - Intergenic
976358652 4:84151037-84151059 CATATACGACCCAAGGAGAGAGG + Intergenic
977617193 4:99099754-99099776 CCTTTCCTACCCAAGGAAAGGGG - Intergenic
978006690 4:103625973-103625995 CTTTTACAAGCCAAGGAGAGAGG + Intronic
978040865 4:104059780-104059802 CTTTTACAAGCCAAGGAGAGAGG - Intergenic
979154833 4:117371440-117371462 CCAATAACAGCTAAGGAGAGAGG - Intergenic
979822610 4:125192258-125192280 CCATGACCACCCAAGGGCTGAGG + Intergenic
980501506 4:133660738-133660760 CCATTTCAACCCAAAGAGACAGG - Intergenic
982214430 4:153068051-153068073 CCTCTACAAGCCAAGGAGAGAGG - Intergenic
982813680 4:159858317-159858339 CCCTTACCATCCTAGGAGAAAGG - Intergenic
982868741 4:160550112-160550134 CCATCACCACCCAAGGGCTGAGG - Intergenic
984613144 4:181864380-181864402 CCATTGGCACCCAAGTAGACGGG - Intergenic
990063943 5:51688937-51688959 CATTTACAAGCCAAGGAGAGAGG + Intergenic
990333486 5:54749904-54749926 CCTCTACAAGCCAAGGAGAGAGG + Intergenic
992646747 5:78818553-78818575 CCATTTAAACCCAAGGAAAGTGG - Intronic
993820847 5:92614659-92614681 ACAATAGCACCCTAGGAGAGAGG + Intergenic
995832730 5:116371887-116371909 CCAATATCACCCAAGGAAAAGGG - Intronic
995921388 5:117318359-117318381 CCCTTACCACCCAGGGGAAGGGG - Intergenic
998310668 5:141126874-141126896 CCACACCCAGCCAAGGAGAGGGG - Intronic
999666469 5:153917709-153917731 CCATTCCCAGCCAAGGGGAATGG - Intergenic
999712823 5:154333335-154333357 ACTTAACCACCCAAGGCGAGTGG - Intronic
999962520 5:156772101-156772123 CCATTACAAACCAAGGGAAGAGG + Intergenic
1000246009 5:159449071-159449093 CCATTACCACCCAAGGAGAGAGG - Intergenic
1000614594 5:163413226-163413248 CTCTTACCACTCTAGGAGAGGGG + Intergenic
1001555188 5:172632307-172632329 CCATTACTATCCCAGGAGAGAGG - Intergenic
1003003536 6:2359923-2359945 CCTCTACAAGCCAAGGAGAGGGG + Intergenic
1006962699 6:37949879-37949901 CCATAAAAACCCAAGAAGAGAGG - Intronic
1007952458 6:45884522-45884544 CCAGTTCCAGCCAATGAGAGAGG - Intergenic
1009570665 6:65379817-65379839 CCATTAACAGACAAGCAGAGAGG + Intronic
1009791428 6:68405975-68405997 CCATTTACACCAAAGGAAAGAGG + Intergenic
1010980171 6:82363253-82363275 CCATCACTACCCAAGAAGTGAGG + Intronic
1012809915 6:103944169-103944191 TCATTACAAACCAAGAAGAGAGG - Intergenic
1012851046 6:104446643-104446665 CCATCACCACCCAAGGGCAGAGG + Intergenic
1015468408 6:133574425-133574447 CTATTGACACCCAAGGAGAAGGG - Intergenic
1017565128 6:155675593-155675615 AAATCACCACCCAACGAGAGAGG - Intergenic
1017663067 6:156692410-156692432 CATCTACCAGCCAAGGAGAGAGG - Intergenic
1017777421 6:157691021-157691043 CCACTGGCACTCAAGGAGAGGGG + Intergenic
1019790111 7:3006463-3006485 CCATTCCCTCCCCAGGAAAGTGG + Intronic
1019799808 7:3079971-3079993 CCTCTACAAGCCAAGGAGAGAGG + Intergenic
1020468980 7:8513961-8513983 CCTCTACAAGCCAAGGAGAGAGG - Intronic
1022853657 7:34293876-34293898 CCATTACCACCCCAGGAGTGGGG + Intergenic
1028458292 7:91062300-91062322 CCTTTCCCAGCCAAGGAAAGGGG - Intronic
1029193770 7:98790037-98790059 CCTCTACAAGCCAAGGAGAGAGG - Intergenic
1029852095 7:103473050-103473072 ACATTACCACCCAGGGTCAGAGG + Intronic
1030302522 7:107988803-107988825 CCATCCCGAACCAAGGAGAGAGG + Intronic
1032791747 7:135247562-135247584 CCAGTTCCAACCAATGAGAGGGG - Intronic
1036190638 8:6666915-6666937 CCCTTTGCAGCCAAGGAGAGAGG - Intergenic
1039792708 8:40888300-40888322 CCCTTACAAACTAAGGAGAGTGG + Intronic
1041081239 8:54216806-54216828 GCATTTTCAGCCAAGGAGAGTGG + Intergenic
1041114159 8:54518072-54518094 CCAGTACCAAGCAAGCAGAGTGG + Intergenic
1041554440 8:59136946-59136968 CATCTACCAGCCAAGGAGAGAGG - Intergenic
1043692339 8:83169659-83169681 CCATCAGCAAGCAAGGAGAGAGG + Intergenic
1048027394 8:130599238-130599260 CATTTACAAACCAAGGAGAGAGG + Intergenic
1048148093 8:131865150-131865172 CCATTACAAATCAAGGAGAGAGG + Intergenic
1050332341 9:4557972-4557994 TCATTACAACCCAAGGAGGCGGG - Intronic
1051600319 9:18865889-18865911 GCATTTCCACCCCAGGAAAGAGG - Intronic
1051714225 9:19964681-19964703 AGATTCCCACCCAAGGAGAAGGG + Intergenic
1055162350 9:73145619-73145641 CCATCCACAGCCAAGGAGAGAGG - Intergenic
1056225276 9:84489168-84489190 CCATGACCACCACTGGAGAGTGG + Intergenic
1057745155 9:97745467-97745489 CCAATAAGATCCAAGGAGAGAGG + Intergenic
1057777410 9:98022106-98022128 CCATCCCCAGCCAAGGAGAAAGG - Intergenic
1058121537 9:101144550-101144572 CCATCTCAACCCAAGGAGAGAGG + Intronic
1058538862 9:105991408-105991430 CTATTTCCACCCATGGAGAGGGG - Intergenic
1062309483 9:135928395-135928417 CCATCTCCACTCAAGGACAGGGG + Intergenic
1185700211 X:2225992-2226014 CATCTACAACCCAAGGAGAGAGG + Intronic
1186112159 X:6269967-6269989 CATTTACAAGCCAAGGAGAGAGG - Intergenic
1187127666 X:16469293-16469315 ACACCACCACCCAAGCAGAGGGG + Intergenic
1187353270 X:18542171-18542193 CCATTGACACCCACTGAGAGGGG + Intronic
1188003336 X:25002014-25002036 CCCTGACCACCCCAGGAAAGCGG + Intergenic
1188846769 X:35082171-35082193 CATCTACCAGCCAAGGAGAGAGG + Intergenic
1190492573 X:50997660-50997682 CAACTACAAGCCAAGGAGAGAGG + Intergenic
1191618583 X:63192577-63192599 CCATCACCACCCAAGGGCTGAGG - Intergenic
1192802565 X:74480383-74480405 CCTTTCCCAGCCAAGGAAAGGGG - Intronic
1193875681 X:86859891-86859913 CATTTACAAGCCAAGGAGAGAGG - Intergenic
1194207331 X:91028059-91028081 CCATTGTCAGCCAAGGAGTGAGG + Intergenic
1194794536 X:98194883-98194905 CATTTACAAGCCAAGGAGAGAGG - Intergenic
1198504920 X:137291934-137291956 CCACTACCACCTAAGGGGACAGG - Intergenic
1199530320 X:148839432-148839454 CCACTACAACCCAAAGAGATTGG + Intronic
1199663920 X:150081673-150081695 CCATCAGAAGCCAAGGAGAGAGG - Intergenic
1200553073 Y:4602790-4602812 CCATTGTCAGCCAAGGAGTGAGG + Intergenic
1200809971 Y:7473980-7474002 GCACTACAATCCAAGGAGAGAGG - Intergenic
1201299826 Y:12495949-12495971 CATCTACAACCCAAGGAGAGAGG - Intergenic