ID: 1000249584

View in Genome Browser
Species Human (GRCh38)
Location 5:159481354-159481376
Sequence ACCTGTGAGAAACAATATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000249578_1000249584 2 Left 1000249578 5:159481329-159481351 CCTTCTAACAAATGTCCCCCTGT No data
Right 1000249584 5:159481354-159481376 ACCTGTGAGAAACAATATTAGGG No data
1000249577_1000249584 14 Left 1000249577 5:159481317-159481339 CCAAATTTGTGACCTTCTAACAA No data
Right 1000249584 5:159481354-159481376 ACCTGTGAGAAACAATATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000249584 Original CRISPR ACCTGTGAGAAACAATATTA GGG Intergenic
No off target data available for this crispr