ID: 1000249588

View in Genome Browser
Species Human (GRCh38)
Location 5:159481422-159481444
Sequence CTACTCACTGCTTGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000249588_1000249591 7 Left 1000249588 5:159481422-159481444 CCAGCATTTCAAGCAGTGAGTAG No data
Right 1000249591 5:159481452-159481474 AGCTTTACCCCAGGCCTTATAGG No data
1000249588_1000249589 -2 Left 1000249588 5:159481422-159481444 CCAGCATTTCAAGCAGTGAGTAG No data
Right 1000249589 5:159481443-159481465 AGACCAGTAAGCTTTACCCCAGG No data
1000249588_1000249597 27 Left 1000249588 5:159481422-159481444 CCAGCATTTCAAGCAGTGAGTAG No data
Right 1000249597 5:159481472-159481494 AGGTCAACAAACCTGCACCAGGG No data
1000249588_1000249596 26 Left 1000249588 5:159481422-159481444 CCAGCATTTCAAGCAGTGAGTAG No data
Right 1000249596 5:159481471-159481493 TAGGTCAACAAACCTGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000249588 Original CRISPR CTACTCACTGCTTGAAATGC TGG (reversed) Intergenic
No off target data available for this crispr