ID: 1000249590

View in Genome Browser
Species Human (GRCh38)
Location 5:159481446-159481468
Sequence AGGCCTGGGGTAAAGCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000249590_1000249597 3 Left 1000249590 5:159481446-159481468 CCAGTAAGCTTTACCCCAGGCCT No data
Right 1000249597 5:159481472-159481494 AGGTCAACAAACCTGCACCAGGG No data
1000249590_1000249596 2 Left 1000249590 5:159481446-159481468 CCAGTAAGCTTTACCCCAGGCCT No data
Right 1000249596 5:159481471-159481493 TAGGTCAACAAACCTGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000249590 Original CRISPR AGGCCTGGGGTAAAGCTTAC TGG (reversed) Intergenic
No off target data available for this crispr