ID: 1000250213

View in Genome Browser
Species Human (GRCh38)
Location 5:159487374-159487396
Sequence GAGAGCCACCTGCCAAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000250213_1000250221 14 Left 1000250213 5:159487374-159487396 CCCTGCCTTGGCAGGTGGCTCTC No data
Right 1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG No data
1000250213_1000250223 23 Left 1000250213 5:159487374-159487396 CCCTGCCTTGGCAGGTGGCTCTC No data
Right 1000250223 5:159487420-159487442 TCAGACCTCCTGGGAACAGGCGG No data
1000250213_1000250222 20 Left 1000250213 5:159487374-159487396 CCCTGCCTTGGCAGGTGGCTCTC No data
Right 1000250222 5:159487417-159487439 CTCTCAGACCTCCTGGGAACAGG No data
1000250213_1000250220 13 Left 1000250213 5:159487374-159487396 CCCTGCCTTGGCAGGTGGCTCTC No data
Right 1000250220 5:159487410-159487432 AGGGTATCTCTCAGACCTCCTGG No data
1000250213_1000250217 -7 Left 1000250213 5:159487374-159487396 CCCTGCCTTGGCAGGTGGCTCTC No data
Right 1000250217 5:159487390-159487412 GGCTCTCACGGATAATGTCCAGG No data
1000250213_1000250218 -6 Left 1000250213 5:159487374-159487396 CCCTGCCTTGGCAGGTGGCTCTC No data
Right 1000250218 5:159487391-159487413 GCTCTCACGGATAATGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000250213 Original CRISPR GAGAGCCACCTGCCAAGGCA GGG (reversed) Intergenic
No off target data available for this crispr