ID: 1000250214

View in Genome Browser
Species Human (GRCh38)
Location 5:159487375-159487397
Sequence TGAGAGCCACCTGCCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000250214_1000250220 12 Left 1000250214 5:159487375-159487397 CCTGCCTTGGCAGGTGGCTCTCA No data
Right 1000250220 5:159487410-159487432 AGGGTATCTCTCAGACCTCCTGG No data
1000250214_1000250218 -7 Left 1000250214 5:159487375-159487397 CCTGCCTTGGCAGGTGGCTCTCA No data
Right 1000250218 5:159487391-159487413 GCTCTCACGGATAATGTCCAGGG No data
1000250214_1000250222 19 Left 1000250214 5:159487375-159487397 CCTGCCTTGGCAGGTGGCTCTCA No data
Right 1000250222 5:159487417-159487439 CTCTCAGACCTCCTGGGAACAGG No data
1000250214_1000250221 13 Left 1000250214 5:159487375-159487397 CCTGCCTTGGCAGGTGGCTCTCA No data
Right 1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG No data
1000250214_1000250223 22 Left 1000250214 5:159487375-159487397 CCTGCCTTGGCAGGTGGCTCTCA No data
Right 1000250223 5:159487420-159487442 TCAGACCTCCTGGGAACAGGCGG No data
1000250214_1000250217 -8 Left 1000250214 5:159487375-159487397 CCTGCCTTGGCAGGTGGCTCTCA No data
Right 1000250217 5:159487390-159487412 GGCTCTCACGGATAATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000250214 Original CRISPR TGAGAGCCACCTGCCAAGGC AGG (reversed) Intergenic