ID: 1000250216

View in Genome Browser
Species Human (GRCh38)
Location 5:159487379-159487401
Sequence TCCGTGAGAGCCACCTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000250216_1000250220 8 Left 1000250216 5:159487379-159487401 CCTTGGCAGGTGGCTCTCACGGA No data
Right 1000250220 5:159487410-159487432 AGGGTATCTCTCAGACCTCCTGG No data
1000250216_1000250223 18 Left 1000250216 5:159487379-159487401 CCTTGGCAGGTGGCTCTCACGGA No data
Right 1000250223 5:159487420-159487442 TCAGACCTCCTGGGAACAGGCGG No data
1000250216_1000250222 15 Left 1000250216 5:159487379-159487401 CCTTGGCAGGTGGCTCTCACGGA No data
Right 1000250222 5:159487417-159487439 CTCTCAGACCTCCTGGGAACAGG No data
1000250216_1000250221 9 Left 1000250216 5:159487379-159487401 CCTTGGCAGGTGGCTCTCACGGA No data
Right 1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000250216 Original CRISPR TCCGTGAGAGCCACCTGCCA AGG (reversed) Intergenic