ID: 1000250217

View in Genome Browser
Species Human (GRCh38)
Location 5:159487390-159487412
Sequence GGCTCTCACGGATAATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000250213_1000250217 -7 Left 1000250213 5:159487374-159487396 CCCTGCCTTGGCAGGTGGCTCTC No data
Right 1000250217 5:159487390-159487412 GGCTCTCACGGATAATGTCCAGG No data
1000250214_1000250217 -8 Left 1000250214 5:159487375-159487397 CCTGCCTTGGCAGGTGGCTCTCA No data
Right 1000250217 5:159487390-159487412 GGCTCTCACGGATAATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000250217 Original CRISPR GGCTCTCACGGATAATGTCC AGG Intergenic