ID: 1000250221

View in Genome Browser
Species Human (GRCh38)
Location 5:159487411-159487433
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000250213_1000250221 14 Left 1000250213 5:159487374-159487396 CCCTGCCTTGGCAGGTGGCTCTC No data
Right 1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG No data
1000250214_1000250221 13 Left 1000250214 5:159487375-159487397 CCTGCCTTGGCAGGTGGCTCTCA No data
Right 1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG No data
1000250216_1000250221 9 Left 1000250216 5:159487379-159487401 CCTTGGCAGGTGGCTCTCACGGA No data
Right 1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000250221 Original CRISPR GGGTATCTCTCAGACCTCCT GGG Intergenic