ID: 1000251188

View in Genome Browser
Species Human (GRCh38)
Location 5:159497331-159497353
Sequence AAGGGGAAGCAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000251177_1000251188 3 Left 1000251177 5:159497305-159497327 CCTCAGTGGGCTCTGCACCCACA No data
Right 1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG No data
1000251175_1000251188 10 Left 1000251175 5:159497298-159497320 CCCAAGGCCTCAGTGGGCTCTGC No data
Right 1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG No data
1000251174_1000251188 13 Left 1000251174 5:159497295-159497317 CCACCCAAGGCCTCAGTGGGCTC No data
Right 1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG No data
1000251176_1000251188 9 Left 1000251176 5:159497299-159497321 CCAAGGCCTCAGTGGGCTCTGCA 0: 2
1: 0
2: 1
3: 60
4: 373
Right 1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000251188 Original CRISPR AAGGGGAAGCAGAGGGAGGA GGG Intergenic
No off target data available for this crispr