ID: 1000251381

View in Genome Browser
Species Human (GRCh38)
Location 5:159498855-159498877
Sequence CAGGCTGCAGAGCTGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000251372_1000251381 21 Left 1000251372 5:159498811-159498833 CCTTTCAAAGAAATCAGGGGCAG No data
Right 1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG No data
1000251367_1000251381 29 Left 1000251367 5:159498803-159498825 CCCAAAAGCCTTTCAAAGAAATC No data
Right 1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG No data
1000251368_1000251381 28 Left 1000251368 5:159498804-159498826 CCAAAAGCCTTTCAAAGAAATCA No data
Right 1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000251381 Original CRISPR CAGGCTGCAGAGCTGGACAT TGG Intergenic
No off target data available for this crispr