ID: 1000254598

View in Genome Browser
Species Human (GRCh38)
Location 5:159525769-159525791
Sequence TATCACCTAGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000254598_1000254603 -7 Left 1000254598 5:159525769-159525791 CCCTCCTCCTTCTCTAGGTGATA No data
Right 1000254603 5:159525785-159525807 GGTGATATTAGTCTGCTAGGTGG No data
1000254598_1000254602 -10 Left 1000254598 5:159525769-159525791 CCCTCCTCCTTCTCTAGGTGATA No data
Right 1000254602 5:159525782-159525804 CTAGGTGATATTAGTCTGCTAGG No data
1000254598_1000254604 30 Left 1000254598 5:159525769-159525791 CCCTCCTCCTTCTCTAGGTGATA No data
Right 1000254604 5:159525822-159525844 TAAATTCAAAAGTACTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000254598 Original CRISPR TATCACCTAGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr