ID: 1000255049

View in Genome Browser
Species Human (GRCh38)
Location 5:159529631-159529653
Sequence AGTCATAATCAAGAATGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000255048_1000255049 4 Left 1000255048 5:159529604-159529626 CCAGAAGAGCATAAAACAGGGGA No data
Right 1000255049 5:159529631-159529653 AGTCATAATCAAGAATGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000255049 Original CRISPR AGTCATAATCAAGAATGTCG AGG Intergenic
No off target data available for this crispr