ID: 1000258558

View in Genome Browser
Species Human (GRCh38)
Location 5:159564024-159564046
Sequence ATGTTTCAACTTAATAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000258558_1000258559 3 Left 1000258558 5:159564024-159564046 CCTCATTTATTAAGTTGAAACAT No data
Right 1000258559 5:159564050-159564072 ATTTAATGTTGCTTTTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000258558 Original CRISPR ATGTTTCAACTTAATAAATG AGG (reversed) Intergenic
No off target data available for this crispr