ID: 1000267877

View in Genome Browser
Species Human (GRCh38)
Location 5:159655625-159655647
Sequence CTAAGAGTTTTACTGAGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000267872_1000267877 -8 Left 1000267872 5:159655610-159655632 CCCTGCCTCTGCCTTCTAAGAGT No data
Right 1000267877 5:159655625-159655647 CTAAGAGTTTTACTGAGTGCGGG No data
1000267873_1000267877 -9 Left 1000267873 5:159655611-159655633 CCTGCCTCTGCCTTCTAAGAGTT No data
Right 1000267877 5:159655625-159655647 CTAAGAGTTTTACTGAGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000267877 Original CRISPR CTAAGAGTTTTACTGAGTGC GGG Intergenic
No off target data available for this crispr