ID: 1000268534

View in Genome Browser
Species Human (GRCh38)
Location 5:159660588-159660610
Sequence ATACATTTTTATCTTTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000268534_1000268536 -2 Left 1000268534 5:159660588-159660610 CCAGGCTAAAGATAAAAATGTAT No data
Right 1000268536 5:159660609-159660631 ATGAGTCATAGGCATAGAGATGG No data
1000268534_1000268537 18 Left 1000268534 5:159660588-159660610 CCAGGCTAAAGATAAAAATGTAT No data
Right 1000268537 5:159660629-159660651 TGGTATTTAAGCAATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000268534 Original CRISPR ATACATTTTTATCTTTAGCC TGG (reversed) Intergenic
No off target data available for this crispr