ID: 1000276333

View in Genome Browser
Species Human (GRCh38)
Location 5:159738763-159738785
Sequence AGGAGGGAAAAGAACTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000276333_1000276342 10 Left 1000276333 5:159738763-159738785 CCCCAGGAGTTCTTTTCCCTCCT No data
Right 1000276342 5:159738796-159738818 CCATTTAGCATTTCAAGTGATGG No data
1000276333_1000276343 17 Left 1000276333 5:159738763-159738785 CCCCAGGAGTTCTTTTCCCTCCT No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000276333 Original CRISPR AGGAGGGAAAAGAACTCCTG GGG (reversed) Intergenic
No off target data available for this crispr