ID: 1000276338

View in Genome Browser
Species Human (GRCh38)
Location 5:159738779-159738801
Sequence AAATGGCCAGTACCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000276338_1000276344 27 Left 1000276338 5:159738779-159738801 CCCTCCTTTGGTACTGGCCATTT No data
Right 1000276344 5:159738829-159738851 TCAGAAAGAAGTGCTCACTCAGG No data
1000276338_1000276342 -6 Left 1000276338 5:159738779-159738801 CCCTCCTTTGGTACTGGCCATTT No data
Right 1000276342 5:159738796-159738818 CCATTTAGCATTTCAAGTGATGG No data
1000276338_1000276343 1 Left 1000276338 5:159738779-159738801 CCCTCCTTTGGTACTGGCCATTT No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000276338 Original CRISPR AAATGGCCAGTACCAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr