ID: 1000276340

View in Genome Browser
Species Human (GRCh38)
Location 5:159738783-159738805
Sequence TGCTAAATGGCCAGTACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000276340_1000276344 23 Left 1000276340 5:159738783-159738805 CCTTTGGTACTGGCCATTTAGCA No data
Right 1000276344 5:159738829-159738851 TCAGAAAGAAGTGCTCACTCAGG No data
1000276340_1000276342 -10 Left 1000276340 5:159738783-159738805 CCTTTGGTACTGGCCATTTAGCA No data
Right 1000276342 5:159738796-159738818 CCATTTAGCATTTCAAGTGATGG No data
1000276340_1000276343 -3 Left 1000276340 5:159738783-159738805 CCTTTGGTACTGGCCATTTAGCA No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000276340 Original CRISPR TGCTAAATGGCCAGTACCAA AGG (reversed) Intergenic
No off target data available for this crispr