ID: 1000276343

View in Genome Browser
Species Human (GRCh38)
Location 5:159738803-159738825
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000276335_1000276343 15 Left 1000276335 5:159738765-159738787 CCAGGAGTTCTTTTCCCTCCTTT No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data
1000276338_1000276343 1 Left 1000276338 5:159738779-159738801 CCCTCCTTTGGTACTGGCCATTT No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data
1000276333_1000276343 17 Left 1000276333 5:159738763-159738785 CCCCAGGAGTTCTTTTCCCTCCT No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data
1000276334_1000276343 16 Left 1000276334 5:159738764-159738786 CCCAGGAGTTCTTTTCCCTCCTT No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data
1000276339_1000276343 0 Left 1000276339 5:159738780-159738802 CCTCCTTTGGTACTGGCCATTTA No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data
1000276340_1000276343 -3 Left 1000276340 5:159738783-159738805 CCTTTGGTACTGGCCATTTAGCA No data
Right 1000276343 5:159738803-159738825 GCATTTCAAGTGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000276343 Original CRISPR GCATTTCAAGTGATGGAGAA AGG Intergenic
No off target data available for this crispr