ID: 1000276344

View in Genome Browser
Species Human (GRCh38)
Location 5:159738829-159738851
Sequence TCAGAAAGAAGTGCTCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000276340_1000276344 23 Left 1000276340 5:159738783-159738805 CCTTTGGTACTGGCCATTTAGCA No data
Right 1000276344 5:159738829-159738851 TCAGAAAGAAGTGCTCACTCAGG No data
1000276339_1000276344 26 Left 1000276339 5:159738780-159738802 CCTCCTTTGGTACTGGCCATTTA No data
Right 1000276344 5:159738829-159738851 TCAGAAAGAAGTGCTCACTCAGG No data
1000276338_1000276344 27 Left 1000276338 5:159738779-159738801 CCCTCCTTTGGTACTGGCCATTT No data
Right 1000276344 5:159738829-159738851 TCAGAAAGAAGTGCTCACTCAGG No data
1000276341_1000276344 10 Left 1000276341 5:159738796-159738818 CCATTTAGCATTTCAAGTGATGG No data
Right 1000276344 5:159738829-159738851 TCAGAAAGAAGTGCTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000276344 Original CRISPR TCAGAAAGAAGTGCTCACTC AGG Intergenic
No off target data available for this crispr