ID: 1000276603

View in Genome Browser
Species Human (GRCh38)
Location 5:159742120-159742142
Sequence CCATGCTGCTAGGCACATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000276595_1000276603 5 Left 1000276595 5:159742092-159742114 CCACACATATGGGGATATGTGGG No data
Right 1000276603 5:159742120-159742142 CCATGCTGCTAGGCACATATGGG No data
1000276591_1000276603 15 Left 1000276591 5:159742082-159742104 CCATGATGTTCCACACATATGGG No data
Right 1000276603 5:159742120-159742142 CCATGCTGCTAGGCACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000276603 Original CRISPR CCATGCTGCTAGGCACATAT GGG Intergenic
No off target data available for this crispr