ID: 1000282864

View in Genome Browser
Species Human (GRCh38)
Location 5:159797290-159797312
Sequence TCCACCCATGAGATCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000282864_1000282869 3 Left 1000282864 5:159797290-159797312 CCCAGGCAGATCTCATGGGTGGA No data
Right 1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG No data
1000282864_1000282867 -10 Left 1000282864 5:159797290-159797312 CCCAGGCAGATCTCATGGGTGGA No data
Right 1000282867 5:159797303-159797325 CATGGGTGGAGGACAGAATAAGG No data
1000282864_1000282868 -7 Left 1000282864 5:159797290-159797312 CCCAGGCAGATCTCATGGGTGGA No data
Right 1000282868 5:159797306-159797328 GGGTGGAGGACAGAATAAGGAGG No data
1000282864_1000282870 4 Left 1000282864 5:159797290-159797312 CCCAGGCAGATCTCATGGGTGGA No data
Right 1000282870 5:159797317-159797339 AGAATAAGGAGGAGAATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000282864 Original CRISPR TCCACCCATGAGATCTGCCT GGG (reversed) Intergenic
No off target data available for this crispr