ID: 1000282869

View in Genome Browser
Species Human (GRCh38)
Location 5:159797316-159797338
Sequence CAGAATAAGGAGGAGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000282864_1000282869 3 Left 1000282864 5:159797290-159797312 CCCAGGCAGATCTCATGGGTGGA No data
Right 1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG No data
1000282865_1000282869 2 Left 1000282865 5:159797291-159797313 CCAGGCAGATCTCATGGGTGGAG No data
Right 1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000282869 Original CRISPR CAGAATAAGGAGGAGAATCC TGG Intergenic
No off target data available for this crispr