ID: 1000283472

View in Genome Browser
Species Human (GRCh38)
Location 5:159803757-159803779
Sequence TTGCCTCCAAGGTGTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000283469_1000283472 6 Left 1000283469 5:159803728-159803750 CCGGTGATCGATAAACACCTGTC No data
Right 1000283472 5:159803757-159803779 TTGCCTCCAAGGTGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000283472 Original CRISPR TTGCCTCCAAGGTGTCTTCC AGG Intergenic
No off target data available for this crispr