ID: 1000284534

View in Genome Browser
Species Human (GRCh38)
Location 5:159815719-159815741
Sequence CTGTGTCATCACTTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000284534_1000284544 30 Left 1000284534 5:159815719-159815741 CCTTCCACCAAGTGATGACACAG No data
Right 1000284544 5:159815772-159815794 TTCCCCAGGCAAGTTGATCTTGG No data
1000284534_1000284539 4 Left 1000284534 5:159815719-159815741 CCTTCCACCAAGTGATGACACAG No data
Right 1000284539 5:159815746-159815768 AAGGTGCCATTTATGAGGAATGG 0: 3
1: 14
2: 40
3: 84
4: 328
1000284534_1000284542 16 Left 1000284534 5:159815719-159815741 CCTTCCACCAAGTGATGACACAG No data
Right 1000284542 5:159815758-159815780 ATGAGGAATGGGCCTTCCCCAGG No data
1000284534_1000284540 5 Left 1000284534 5:159815719-159815741 CCTTCCACCAAGTGATGACACAG No data
Right 1000284540 5:159815747-159815769 AGGTGCCATTTATGAGGAATGGG 0: 3
1: 17
2: 64
3: 159
4: 323
1000284534_1000284538 -1 Left 1000284534 5:159815719-159815741 CCTTCCACCAAGTGATGACACAG No data
Right 1000284538 5:159815741-159815763 GTTAAAAGGTGCCATTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000284534 Original CRISPR CTGTGTCATCACTTGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr