ID: 1000288174

View in Genome Browser
Species Human (GRCh38)
Location 5:159846084-159846106
Sequence ATGTGGACCTAGAAGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000288174_1000288184 29 Left 1000288174 5:159846084-159846106 CCCTGACTCTTCTAGGTCCACAT No data
Right 1000288184 5:159846136-159846158 CTCTTTTTTGATGCCCTGCATGG No data
1000288174_1000288178 -2 Left 1000288174 5:159846084-159846106 CCCTGACTCTTCTAGGTCCACAT No data
Right 1000288178 5:159846105-159846127 ATCTATGGTGACCCCTTGCATGG No data
1000288174_1000288185 30 Left 1000288174 5:159846084-159846106 CCCTGACTCTTCTAGGTCCACAT No data
Right 1000288185 5:159846137-159846159 TCTTTTTTGATGCCCTGCATGGG No data
1000288174_1000288179 2 Left 1000288174 5:159846084-159846106 CCCTGACTCTTCTAGGTCCACAT No data
Right 1000288179 5:159846109-159846131 ATGGTGACCCCTTGCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000288174 Original CRISPR ATGTGGACCTAGAAGAGTCA GGG (reversed) Intergenic
No off target data available for this crispr