ID: 1000288197

View in Genome Browser
Species Human (GRCh38)
Location 5:159846188-159846210
Sequence TCCCTTGGGGACCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000288197_1000288203 1 Left 1000288197 5:159846188-159846210 CCAGCCTCAGGGTCCCCAAGGGA No data
Right 1000288203 5:159846212-159846234 CACGAGCTGCCATCCCCATTGGG No data
1000288197_1000288208 19 Left 1000288197 5:159846188-159846210 CCAGCCTCAGGGTCCCCAAGGGA No data
Right 1000288208 5:159846230-159846252 TTGGGTCTCTTTATCCCCTTAGG No data
1000288197_1000288202 0 Left 1000288197 5:159846188-159846210 CCAGCCTCAGGGTCCCCAAGGGA No data
Right 1000288202 5:159846211-159846233 GCACGAGCTGCCATCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000288197 Original CRISPR TCCCTTGGGGACCCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr