ID: 1000288862

View in Genome Browser
Species Human (GRCh38)
Location 5:159851077-159851099
Sequence GCTCTCCGTTTGTTAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000288862_1000288865 -6 Left 1000288862 5:159851077-159851099 CCCTTTGTTAACAAACGGAGAGC No data
Right 1000288865 5:159851094-159851116 GAGAGCAGGCCCACACCAATAGG No data
1000288862_1000288869 15 Left 1000288862 5:159851077-159851099 CCCTTTGTTAACAAACGGAGAGC No data
Right 1000288869 5:159851115-159851137 GGCAAACAGCACAGCTTGCTTGG No data
1000288862_1000288870 16 Left 1000288862 5:159851077-159851099 CCCTTTGTTAACAAACGGAGAGC No data
Right 1000288870 5:159851116-159851138 GCAAACAGCACAGCTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000288862 Original CRISPR GCTCTCCGTTTGTTAACAAA GGG (reversed) Intergenic
No off target data available for this crispr