ID: 1000289914

View in Genome Browser
Species Human (GRCh38)
Location 5:159860682-159860704
Sequence AGGGCTTTGGTCCTTAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000289914_1000289920 8 Left 1000289914 5:159860682-159860704 CCTGATCTAAGGACCAAAGCCCT No data
Right 1000289920 5:159860713-159860735 CTTCCACTATCTACAGACACAGG No data
1000289914_1000289924 24 Left 1000289914 5:159860682-159860704 CCTGATCTAAGGACCAAAGCCCT No data
Right 1000289924 5:159860729-159860751 ACACAGGTGAGGAACATCCAGGG No data
1000289914_1000289922 13 Left 1000289914 5:159860682-159860704 CCTGATCTAAGGACCAAAGCCCT No data
Right 1000289922 5:159860718-159860740 ACTATCTACAGACACAGGTGAGG No data
1000289914_1000289923 23 Left 1000289914 5:159860682-159860704 CCTGATCTAAGGACCAAAGCCCT No data
Right 1000289923 5:159860728-159860750 GACACAGGTGAGGAACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000289914 Original CRISPR AGGGCTTTGGTCCTTAGATC AGG (reversed) Intergenic
No off target data available for this crispr