ID: 1000289915

View in Genome Browser
Species Human (GRCh38)
Location 5:159860695-159860717
Sequence GGAAGGAGGAGACAGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000289915_1000289924 11 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289924 5:159860729-159860751 ACACAGGTGAGGAACATCCAGGG No data
1000289915_1000289925 27 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289925 5:159860745-159860767 TCCAGGGTGCCTCAGAGCACAGG No data
1000289915_1000289923 10 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289923 5:159860728-159860750 GACACAGGTGAGGAACATCCAGG No data
1000289915_1000289927 28 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289927 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data
1000289915_1000289922 0 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289922 5:159860718-159860740 ACTATCTACAGACACAGGTGAGG No data
1000289915_1000289920 -5 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289920 5:159860713-159860735 CTTCCACTATCTACAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000289915 Original CRISPR GGAAGGAGGAGACAGGGCTT TGG (reversed) Intergenic
No off target data available for this crispr