ID: 1000289917

View in Genome Browser
Species Human (GRCh38)
Location 5:159860702-159860724
Sequence AGATAGTGGAAGGAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000289917_1000289927 21 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289927 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data
1000289917_1000289928 24 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289928 5:159860749-159860771 GGGTGCCTCAGAGCACAGGGTGG No data
1000289917_1000289922 -7 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289922 5:159860718-159860740 ACTATCTACAGACACAGGTGAGG No data
1000289917_1000289924 4 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289924 5:159860729-159860751 ACACAGGTGAGGAACATCCAGGG No data
1000289917_1000289925 20 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289925 5:159860745-159860767 TCCAGGGTGCCTCAGAGCACAGG No data
1000289917_1000289923 3 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289923 5:159860728-159860750 GACACAGGTGAGGAACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000289917 Original CRISPR AGATAGTGGAAGGAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr