ID: 1000289920

View in Genome Browser
Species Human (GRCh38)
Location 5:159860713-159860735
Sequence CTTCCACTATCTACAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000289915_1000289920 -5 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289920 5:159860713-159860735 CTTCCACTATCTACAGACACAGG No data
1000289914_1000289920 8 Left 1000289914 5:159860682-159860704 CCTGATCTAAGGACCAAAGCCCT No data
Right 1000289920 5:159860713-159860735 CTTCCACTATCTACAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000289920 Original CRISPR CTTCCACTATCTACAGACAC AGG Intergenic
No off target data available for this crispr