ID: 1000289922

View in Genome Browser
Species Human (GRCh38)
Location 5:159860718-159860740
Sequence ACTATCTACAGACACAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000289915_1000289922 0 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289922 5:159860718-159860740 ACTATCTACAGACACAGGTGAGG No data
1000289914_1000289922 13 Left 1000289914 5:159860682-159860704 CCTGATCTAAGGACCAAAGCCCT No data
Right 1000289922 5:159860718-159860740 ACTATCTACAGACACAGGTGAGG No data
1000289916_1000289922 -6 Left 1000289916 5:159860701-159860723 CCCTGTCTCCTCCTTCCACTATC No data
Right 1000289922 5:159860718-159860740 ACTATCTACAGACACAGGTGAGG No data
1000289917_1000289922 -7 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289922 5:159860718-159860740 ACTATCTACAGACACAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000289922 Original CRISPR ACTATCTACAGACACAGGTG AGG Intergenic
No off target data available for this crispr