ID: 1000289927

View in Genome Browser
Species Human (GRCh38)
Location 5:159860746-159860768
Sequence CCAGGGTGCCTCAGAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000289917_1000289927 21 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289927 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data
1000289918_1000289927 14 Left 1000289918 5:159860709-159860731 CCTCCTTCCACTATCTACAGACA No data
Right 1000289927 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data
1000289916_1000289927 22 Left 1000289916 5:159860701-159860723 CCCTGTCTCCTCCTTCCACTATC No data
Right 1000289927 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data
1000289919_1000289927 11 Left 1000289919 5:159860712-159860734 CCTTCCACTATCTACAGACACAG No data
Right 1000289927 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data
1000289915_1000289927 28 Left 1000289915 5:159860695-159860717 CCAAAGCCCTGTCTCCTCCTTCC No data
Right 1000289927 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data
1000289921_1000289927 7 Left 1000289921 5:159860716-159860738 CCACTATCTACAGACACAGGTGA No data
Right 1000289927 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000289927 Original CRISPR CCAGGGTGCCTCAGAGCACA GGG Intergenic
No off target data available for this crispr