ID: 1000289928

View in Genome Browser
Species Human (GRCh38)
Location 5:159860749-159860771
Sequence GGGTGCCTCAGAGCACAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000289919_1000289928 14 Left 1000289919 5:159860712-159860734 CCTTCCACTATCTACAGACACAG No data
Right 1000289928 5:159860749-159860771 GGGTGCCTCAGAGCACAGGGTGG No data
1000289918_1000289928 17 Left 1000289918 5:159860709-159860731 CCTCCTTCCACTATCTACAGACA No data
Right 1000289928 5:159860749-159860771 GGGTGCCTCAGAGCACAGGGTGG No data
1000289921_1000289928 10 Left 1000289921 5:159860716-159860738 CCACTATCTACAGACACAGGTGA No data
Right 1000289928 5:159860749-159860771 GGGTGCCTCAGAGCACAGGGTGG No data
1000289917_1000289928 24 Left 1000289917 5:159860702-159860724 CCTGTCTCCTCCTTCCACTATCT No data
Right 1000289928 5:159860749-159860771 GGGTGCCTCAGAGCACAGGGTGG No data
1000289916_1000289928 25 Left 1000289916 5:159860701-159860723 CCCTGTCTCCTCCTTCCACTATC No data
Right 1000289928 5:159860749-159860771 GGGTGCCTCAGAGCACAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000289928 Original CRISPR GGGTGCCTCAGAGCACAGGG TGG Intergenic
No off target data available for this crispr