ID: 1000289930

View in Genome Browser
Species Human (GRCh38)
Location 5:159860759-159860781
Sequence GAGCACAGGGTGGAAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000289926_1000289930 -10 Left 1000289926 5:159860746-159860768 CCAGGGTGCCTCAGAGCACAGGG No data
Right 1000289930 5:159860759-159860781 GAGCACAGGGTGGAAAGTCCTGG No data
1000289919_1000289930 24 Left 1000289919 5:159860712-159860734 CCTTCCACTATCTACAGACACAG No data
Right 1000289930 5:159860759-159860781 GAGCACAGGGTGGAAAGTCCTGG No data
1000289921_1000289930 20 Left 1000289921 5:159860716-159860738 CCACTATCTACAGACACAGGTGA No data
Right 1000289930 5:159860759-159860781 GAGCACAGGGTGGAAAGTCCTGG No data
1000289918_1000289930 27 Left 1000289918 5:159860709-159860731 CCTCCTTCCACTATCTACAGACA No data
Right 1000289930 5:159860759-159860781 GAGCACAGGGTGGAAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000289930 Original CRISPR GAGCACAGGGTGGAAAGTCC TGG Intergenic
No off target data available for this crispr