ID: 1000291275

View in Genome Browser
Species Human (GRCh38)
Location 5:159873742-159873764
Sequence CACTGTCTAGAGATGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000291275_1000291281 8 Left 1000291275 5:159873742-159873764 CCTCCTTCCATCTCTAGACAGTG No data
Right 1000291281 5:159873773-159873795 TGTCCCCAGTGGAATTTTTCTGG No data
1000291275_1000291279 -3 Left 1000291275 5:159873742-159873764 CCTCCTTCCATCTCTAGACAGTG No data
Right 1000291279 5:159873762-159873784 GTGTGCAGGCCTGTCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000291275 Original CRISPR CACTGTCTAGAGATGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr