ID: 1000291789

View in Genome Browser
Species Human (GRCh38)
Location 5:159877697-159877719
Sequence GGGACAGTACCTACCTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000291789_1000291794 -1 Left 1000291789 5:159877697-159877719 CCCCATAAGGTAGGTACTGTCCC No data
Right 1000291794 5:159877719-159877741 CTAACCCCACTTTATAAGTAAGG No data
1000291789_1000291798 21 Left 1000291789 5:159877697-159877719 CCCCATAAGGTAGGTACTGTCCC No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000291789 Original CRISPR GGGACAGTACCTACCTTATG GGG (reversed) Intergenic