ID: 1000291794

View in Genome Browser
Species Human (GRCh38)
Location 5:159877719-159877741
Sequence CTAACCCCACTTTATAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000291789_1000291794 -1 Left 1000291789 5:159877697-159877719 CCCCATAAGGTAGGTACTGTCCC No data
Right 1000291794 5:159877719-159877741 CTAACCCCACTTTATAAGTAAGG No data
1000291791_1000291794 -3 Left 1000291791 5:159877699-159877721 CCATAAGGTAGGTACTGTCCCTA No data
Right 1000291794 5:159877719-159877741 CTAACCCCACTTTATAAGTAAGG No data
1000291790_1000291794 -2 Left 1000291790 5:159877698-159877720 CCCATAAGGTAGGTACTGTCCCT No data
Right 1000291794 5:159877719-159877741 CTAACCCCACTTTATAAGTAAGG No data
1000291786_1000291794 24 Left 1000291786 5:159877672-159877694 CCATTATGTCTCTCAATGCTCTC No data
Right 1000291794 5:159877719-159877741 CTAACCCCACTTTATAAGTAAGG No data
1000291785_1000291794 25 Left 1000291785 5:159877671-159877693 CCCATTATGTCTCTCAATGCTCT No data
Right 1000291794 5:159877719-159877741 CTAACCCCACTTTATAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000291794 Original CRISPR CTAACCCCACTTTATAAGTA AGG Intergenic